Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: Tumor-intrinsic RRBP1 inhibition triggers antitumor immunity. ( A ) Representative images of IHC staining for RRBP1 and CD8 + T cells in BC samples. ( B ) The correlation between RRBP1 expression and CD8 + T-cell infiltration was analyzed based on 96 patients from in-house BC cohort. Scale bar: 50 µm. ( C ) Representative images of IHC staining for RRBP1 expression in PD, SD, PR, and CR samples. Scale bar: 50 µm. ( D ) Bar plot showed the response rates of anti-PD-L1 therapy. Blue bars represent CR/PR, Red bars represent PD/SD. ( E ) Volcano plot of RNA-seq data for shNC or shRRBP1 tumors (n=3). Differentially expressed genes were identified with the threshold of |log2 (fold change) | >1 and FDR<0.05. ( F ) GSEA for DEGs showed the activation of immune-associated pathways in shRRBP1 tumors in the RNA-seq data. ( G ) Representative images of IHC and mIHC staining for RRBP1 and CD8 + T cells in shNC, shRRBP1, control or radezolid tumor tissues. Expression levels of the indicated proteins were displayed. Scale bar: 20 µm. ( H, I ) Flow cytometry showed the percentages of CD8 + T cells in CD3 + cells in shNC, shRRBP1, control or radezolid tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using Spearman correlation analysis ( B ), unpaired two-tailed t-test ( I ). ****p<0.0001. BC, bladder cancer; CR, complete response; FDR, false discovery rate; progressive disease; PR, partial response; PD-L1, programmed death-ligand 1; RNA-seq, RNA sequencing; RRB1, ribosomal-binding protein 1; SD, stable disease; IHC, immunohistochemistry; GSEA, gene set enrichment analysis; DEGs, differentially expressed genes; mIHC, multiplex immunohistochemistry.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Immunohistochemistry, Expressing, RNA Sequencing, Activation Assay, Staining, Control, Flow Cytometry, Two Tailed Test, Binding Assay, Multiplex Assay

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: Single-cell RNA sequencing reveals the difference of CD8 + T-cell subgroup. The UMAP plot of CD8 + T cells subpopulation, color-coded by cell cluster and cell type. ( A ) The expression of markers in each CD8 + T cells subpopulation. ( B ) Bar plot showed the proportion of CD8 + T cells subpopulation in the shNC and shRRBP1 groups. ( C ) The percentage of each CD8 + T-cell clusters in shNC and shRRBP1 groups. ( D ) Heatmap showed the differentially activated pathway among all the CD8 + T-cell clusters. ( E ) The differentially expressed genes in CD8 + T cells between shNC and shRRBP1 groups. ( F ) KEGG analysis for differentially expressed genes showed the enrichment of immune-associated pathways. ( G, H ) mIHC and flow cytometric analysis displayed the tumor-infiltrating IFN-γ + or GZMB + CD8 + T cells in shNC or shRRBP1 tumor tissues. Scale bar: 20 µm. ( I–K ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Isotype control (IgG) or anti-mouse CD8 antibody administered on days –6, –3, and –1 before tumor challenge, with the same dose repeated on days 7, 9 and 11 after tumor challenge. Tumor sizes ( I ), volumes ( J ), and weight ( K ) were measured. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( H, K ) and two-way ANOVA with Tukey’s multiple comparison test ( J ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. ANOVA, analysis of variance; GZMB, Granzyme B; IFN, interferon; TEX, exhausted T cells; UMAP, Uniform Manifold Approximation and Projection; mIHC, multiplex immunohistochemistry; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Single Cell, RNA Sequencing, Expressing, Injection, Control, Two Tailed Test, Comparison, Multiplex Assay, Immunohistochemistry

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: RRBP1 inhibition promotes antitumor immunity via the CXCL10-CXCR3 axis in BC. ( A ) ScRNA-seq data showed the CXCR3 expression of CD8+T cells in shNC and shRRBP1 groups. ( B ) The correlation between CXCR3 expression and CXCL10 expression or activated CD8 + T cell based on 571 patients from TCGA-BLCA cohort and GSE13507 cohorts. ( C ) MB49 cells were co-cultured with CD8 + T cells, and tumor cells were stained with crystal violet. ( D ) Evaluation of the effect of genetic inhibition of RRBP1 on the cytotoxicity of CD8 + T cells in vitro conditioned culture model. ( E ) Schematic diagram of in vitro CD8 + T-cell migration assays. ( F ) The number of CD8 + T cells passing through the membrane of a Transwell system was analyzed by flow cytometry. ( G–I ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice received intraperitoneal injection of either vehicle or anti-CXCL10 when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( G ), volumes ( H ), and weights ( I ) were measured. ( J ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( K ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( D, F, I, K ) and two-way ANOVA with Tukey’s multiple comparison test ( H ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; RRBP1, ribosomal-binding protein 1; scRNA-seq, single-cell RNA sequencing; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry; BLCA, bladder urothelial carcinoma.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Expressing, Cell Culture, Staining, In Vitro, Migration, Membrane, Flow Cytometry, Injection, Two Tailed Test, Comparison, Binding Assay, Single Cell, RNA Sequencing, Immunohistochemistry, Multiplex Assay

Journal: Journal for Immunotherapy of Cancer

Article Title: Targeting RRBP1 reverses immune evasion and enhances immunotherapy efficacy via the CXCL10-CXCR3 axis in bladder cancer

doi: 10.1136/jitc-2025-013809

Figure Lengend Snippet: RRBP1 inhibition enhances response to anti-PD-L1 therapy in BC. ( A–D ) The protein expression of surface PD-L1 was analyzed in BC cells or tumor tissues by flow cytometry after RRBP1 inhibition and was shown as the mean fluorescence intensity. ( E–G ) C57BL/6 mice were subcutaneously injected with 5×10 5 stable MB49 cells (shNC or shRRBP1 cells) (n=6). Tumor-bearing mice were received intraperitoneal injection of either vehicle or anti-PD-L1 antibody when the tumor volume reached a calculated average of 100 mm 3 . The tumor sizes ( E ), volumes ( F ), and weights ( G ) were measured. ( H ) Representative images of IHC and mIHC staining for CD8, CXCR3, CXCL10, IFN-γ, GZMB in different tumor tissues. ( I ) Flow cytometric analysis of tumor-infiltrating CD8 + T cells, CXCR3 + CD8 + T cells, IFN-γ + CD8 + T cells or GZMB + CD8 + T cells in distinct tumor tissues. Data are represented as mean means±SD. Statistical analysis was performed using unpaired two-tailed t-test ( B, D, G, I ) and two-way ANOVA with Tukey’s multiple comparison test ( F ). The data presented represent on one or three independent experiments. *p<0.01, **p<0.01, ***p<0.001. ANOVA, analysis of variance; BC, bladder cancer; GZMB, Granzyme B; IFN, interferon; PD-L1, programmed death-ligand 1; RRBP1, ribosomal-binding protein 1; IHC, immunohistochemistry; mIHC, multiplex immunohistochemistry.

Article Snippet: Peripheral blood mononuclear cells were isolated by Ficoll density gradient centrifugation, and CD8 + T cells were subsequently enriched using MagCellect Human CD8 + T Cell Isolation Kit (R&D Systems) and the MagCellect Mouse CD8 + T Cell Isolation Kit (R&D Systems) according to the manufacturer’s protocols.

Techniques: Inhibition, Expressing, Flow Cytometry, Fluorescence, Injection, Staining, Two Tailed Test, Comparison, Binding Assay, Immunohistochemistry, Multiplex Assay

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Levels of Nrp1 and Nrp2 mRNA expression in freshly isolated Tw2+ cells vs Pax7+ cells, as determined by RNA-seq. (B) Western blot of NRP1 protein levels in cultured Tw2-derived myoblasts (Tw2-MB) and Pax7-derived myoblasts (Pax7-MB). GAPDH serves as a loading control. (C) Levels of Nrp1 and Nrp2 mRNA expression in Twist2-overexpressing Tw2-MB (Tw2-DM) and GFP-infected Tw2-MB (GFP-DM) after 4 days in differentiation medium, as determined by RNA-seq. (D) Genome browser shot of Twist2 binding at the Nrp1 promoter in both growth media (GM) and differentiation media (DM). (E) (Top panel) Co-immunostaining of Nrp1 (green), Twist2 (red), and Hoechst (blue) in adult mouse transverse section of quadriceps muscle. (Bottom panel) Zoomed in image of top panel. Scale: 50 µm. See also Figure S1

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Expressing, Isolation, RNA Sequencing Assay, Western Blot, Cell Culture, Derivative Assay, Infection, Binding Assay, Immunostaining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Overexpression of Nrp1 increases repulsion of Tw2-MB from Sema3a stripes. (Top) Control Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. (Bottom) Nrp1-overexpressing Tw2-MB (red) were seeded on Sema3a stripes (green) and analyzed 1-day after seeding. Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. (C) Overexpression of Nrp1 resulted in repulsion of Pax7-MB from Sema3a stripes. (Top) Control-infected Pax7-MB (red) were seeded on Sema3a stripes (green) and analyzed 1 day after seeding. (Bottom) Nrp1-overexpresssing Pax7-MB (red) were seeded on Sema3a stripes (green). Cells were analyzed 1 day after seeding and co-stained with Hoechst (blue). Scale bar: 100 µm. (D) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 4C. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. **: p <0.005. See also Figure S4. Source data for 4B and 4C are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Over Expression, Staining, Infection

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Knockdown of Nrp1 by shRNA in Tw2-MB (red) abolished Sema3a avoidance. (Top) Control shRNA (shCtrl) infected Tw2-MB 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Tw2-MB overexpressing either shNrp1–1 or shNrp1–2 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (B) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5A. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. ***: p < 0.0005, ****: p < 0.00005. (C) Western blot showing loss of NRP1 protein in Tw2-MB infected with sgRNAs targeting Nrp1. GAPDH was used as a loading control. (D) (Top) Control pLentiCrisprV2-infected Tw2-MB (red) 1 day after seeding on Sema3a stripes (green). (Middle, Bottom) Two separate Nrp1 sgRNA-infected Tw2-MB (sgNrp1–2 and sgNrp1–5) 1-day after seeding on Sema3a stripes (green). Cells were co-stained with Hoechst (blue). Scale bar: 100 µm. (E) Quantification of Sema3a avoidance as the percent of cells residing off the stripe in Fig. 5D. The dashed line represents the baseline for cells unresponsive to Sema3a. Three separate fields were quantified for each sample with a total of 3 samples per cell type. *: p < 0.05. See also Figure S5. Source data for 5B and E are provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: shRNA, Infection, Staining, Western Blot

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: (A) Experimental scheme for chimeric fusion assay. Tw2-MB were infected with retroviruses expressing shNrp1–2, control empty vector, or Nrp1, and mixed with primary myoblasts (SCs) infected with retroviruses expressing Sema3a-EGFP in equal numbers. Cells were then differentiated for 7 days. (B) SCs over-expressing Sema3a (green) were mixed with Tw2-MB (tdTO+) infected with Nrp1 (top), control empty vector (middle), or shNrp1–2 (bottom) retroviruses and differentiated for 7 days. Cells were fixed and stained with Hoechst (blue) and an antibody against fast myosin (MY32; white). Arrow indicates chimeric myotubes that are both Sema3a+ and tdTO+; * represents myotubes that Sema3a+ only; and arrowhead represents myotubes that are tdTO+ only. Scale bar: 50 µm. (C) Quantification of percent of nuclei in chimeric fibers for Figure 6B. Percent of nuclei in chimeric fibers was calculated as the percent of the number of nuclei in chimeric fibers over the total number of nuclei (red-only, green-only, and chimeric myofibers). Three fields per sample per experiment were quantified. Three separate experiments were performed. *: p < 0.05, **: p < 0.005. See also Figure S6. Source data for 6C is provided in Supplementary Table 1.

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Single Vesicle Fusion Assay, Infection, Expressing, Plasmid Preparation, Staining

Journal: Developmental cell

Article Title: Sema3a-Nrp1 signaling mediates fast-twitch myofiber-specificity of Tw2 + cells

doi: 10.1016/j.devcel.2019.08.002

Figure Lengend Snippet: KEY RESOURCE TABLE

Article Snippet: Twist2 ChIP-Sequencing Li et al. 2019 {"type":"entrez-geo","attrs":{"text":"GSE127998","term_id":"127998"}} GSE127998 Experimental Models: Cell Lines Twist2-derived myoblasts Liu et al. 2017 N/A Pax7-derived myoblasts Liu et al. 2017 N/A Primary myoblasts This Paper N/A Experimental Models: Organisms/Strains Mck-Sema3a transgenic mice This paper N/A Tw2-CreERT2; R26-tdTomato Liu et al. 2017 N/A Mck-Sema3a; Tw2-CreERT2; R26-tdTomato This paper N/A Oligonucleotides Sema3a qPCR Forward Probe - GAAGAGCCCTTATGATCCCAAAC This paper N/A Sema3a qPCR Reverse Probe - AGATAGCGCAAGTCCCGTCCC This paper N/A Nrp1 T7E1 Forward Primer - GAGGGTTTATGGGGGACACT This paper Nrp1 T7E1 Reverse Primer - CAGGACATCTGGGGCTACAT This paper Recombinant DNA pBabe-Nrp1 This paper N/A pBabe-Sema3a-EGFP This paper N/A shNrp1 #1–4 Origene TG513573A pLentiV2-sgNrp1 #1–8 This paper N/A psPax2 Addgene; http://n2t.net/addgene:12260 12260 pMD2.G Addgene; http://n2t.net/addgene:12259 12259 pCRII-TOPO ThermoFisher 45-0640 pBabe-EGFP Addgene; Parker et al. 2012 36999 Software and Algorithms ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ GraphPad Prism 8 GraphPadSoftware https://www.graphpad.com/scientific-software/prism/ Other Silicon Matrix Martin Bastmeyer, Karlsruhe Institute of Technology https://znbio.zoo.kit.edu/Mitarbeiter_66.php Open in a separate window KEY RESOURCE TABLE Tw2 + cells are a type IIb/x fiber-specific muscle progenitor.

Techniques: Recombinant, Isolation, Transgenic Assay, Software

Journal: The Journal of Biological Chemistry

Article Title: AKAP79/150 Interacts with AC8 and Regulates Ca 2+ -dependent cAMP Synthesis in Pancreatic and Neuronal Systems *

doi: 10.1074/jbc.M110.120725

Figure Lengend Snippet: Binding between AKAP79/AKAP150 and the N terminus of AC8. A , GST pull-downs using whole cell lysate from cells transiently expressing tagged AKAP proteins. Lane 1 , GST alone; lanes 2–4 , the following regions of AC8 fused to GST: 1–179 (N terminus), 582–703 (C1b domain), and 1106–1248 (C terminus), respectively. Lane 5 , input control (5%) to confirm expression of each construct. B , top , AKAP79-HA and AKAP150-HA transiently expressed in HEK293 cells were pulled down using GST-fused first half (residues 1–77) or second half (residues 73–179) of the AC8 N terminus. Bottom , immunoblotting of the GST-fused proteins used in the pull-downs in the top . The upper GST bands represent the full-length form of each protein. C , plot of densitometries from 3–6 repeats of blots presented in B to quantify binding of AKAP79/150 to GST-AC8 1–77 versus GST-AC8 73–179. Data are normalized to the intensity of the uppermost GST bands. Error bars , S.E. D , schematic diagram of GST-AC8 constructs used in A–C .

Article Snippet: For knockdown of endogenously expressed AKAP150 in primary cultured hippocampal neurons, shRNA AKAP150 lentiviral particles (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added directly to cultured cells 72 h prior to experiments.

Techniques: Binding Assay, Expressing, Control, Construct, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: AKAP79/150 Interacts with AC8 and Regulates Ca 2+ -dependent cAMP Synthesis in Pancreatic and Neuronal Systems *

doi: 10.1074/jbc.M110.120725

Figure Lengend Snippet: AKAP disruption enhances CCE-induced AC8 activity. A , CCE-mediated increases in cAMP assessed using the FRET-based sensor Epac2-camps following knockdown of endogenous AKAP79 levels. Data are plotted as relative FRET ratio changes normalized to maximum signal response. Cells were pretreated with 200 n m Tg in Ca 2+ -free conditions, and CCE was induced upon the addition of 2 m m Ca 2+ to the bath solution. B , average Fura-2 traces from HEK-AC8 cells during CCE following transfection with AKAP150-HA, AKAP79-HA, or shRNA AKAP79. All data are normalized to maximal Fura-2 signal obtained upon the addition of 5 μ m ionomycin (Ca 2+ ionophore) and 5 m m Ca 2+ . C , effects of the AKAP/PKA disruptor peptide, St-Ht31 (10 μ m ), on CCE-stimulated AC8 activity assessed using Epac2-camps. Experiments were performed in the presence of 100 μ m IBMX, and CCE was induced upon the addition of 0.5 m m Ca 2+ . St-Ht31P (10 μ m ) was used as a negative control. D , analyses of the effects of AKAP79 knockdown or pharmacological AKAP disruption (St-Ht31) on AC8 activity. Plots of peak CCE-induced cAMP increase relative to control ( left chart ) and peak rate of cAMP production ( right chart ) are presented as mean ± S.E. ( error bars ). **, p < 0.001 using Students' t test.

Article Snippet: For knockdown of endogenously expressed AKAP150 in primary cultured hippocampal neurons, shRNA AKAP150 lentiviral particles (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added directly to cultured cells 72 h prior to experiments.

Techniques: Disruption, Activity Assay, Knockdown, Transfection, shRNA, Negative Control, Control

Journal: The Journal of Biological Chemistry

Article Title: AKAP79/150 Interacts with AC8 and Regulates Ca 2+ -dependent cAMP Synthesis in Pancreatic and Neuronal Systems *

doi: 10.1074/jbc.M110.120725

Figure Lengend Snippet: Co-immunoprecipitation of endogenously expressed AC8 and AKAP150 in MIN6 cells. A , Western blot analysis to confirm the endogenous expression of AKAP150 ( left ) and AC8 ( right ) in MIN6 cells. B , immune complexes for endogenous AKAP150 co-purify with AC8 in MIN6 cell lysate. No AC8 band is seen in IgG controls. Antibodies used for immunoprecipitation ( IP ) and subsequent immunoblotting ( IB ) were specific to AKAP150 and AC8, respectively.

Article Snippet: For knockdown of endogenously expressed AKAP150 in primary cultured hippocampal neurons, shRNA AKAP150 lentiviral particles (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added directly to cultured cells 72 h prior to experiments.

Techniques: Immunoprecipitation, Western Blot, Expressing

Journal: The Journal of Biological Chemistry

Article Title: AKAP79/150 Interacts with AC8 and Regulates Ca 2+ -dependent cAMP Synthesis in Pancreatic and Neuronal Systems *

doi: 10.1074/jbc.M110.120725

Figure Lengend Snippet: Effects of AKAP150 on Ca 2+ -stimulated AC8 activity in MIN6 cells. A , Fura-2 data showing the standard protocol for inducing CCE in MIN6 cells. Cells were pretreated with 1 μ m Tg in Ca 2+ -free conditions for 3 min prior to the addition of 2 m m external Ca 2+ . The addition of 100 μ m 2-aminoethoxydiphenyl borate ( 2-APB ; a CCE inhibitor when used at high concentrations) from 1 min onward significantly reduced Ca 2+ entry (see bar chart inset ; ***, p < 0.001). Bi , Epac2-camps data showing the effects of AKAP150 overexpression on Ca 2+ -stimulated cAMP production compared with empty vector controls. 20 n m FSK and 100 μ m IBMX were present throughout. Data are plotted as a percentage of maximal FRET signal obtained using saturating cAMP concentrations. Bii , as above, except that the effects of lentiviral shRNA directed against AKAP150 were compared with scrambled shRNA controls. C , bar charts show mean ± S.E. values ( error bars ) for peak amplitude and rate of FRET ratio changes during CCE for data in B . *, p < 0.05 compared with shRNA controls.

Article Snippet: For knockdown of endogenously expressed AKAP150 in primary cultured hippocampal neurons, shRNA AKAP150 lentiviral particles (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added directly to cultured cells 72 h prior to experiments.

Techniques: Activity Assay, Over Expression, Plasmid Preparation, shRNA

Journal: The Journal of Biological Chemistry

Article Title: AKAP79/150 Interacts with AC8 and Regulates Ca 2+ -dependent cAMP Synthesis in Pancreatic and Neuronal Systems *

doi: 10.1074/jbc.M110.120725

Figure Lengend Snippet: A role for AKAP150 in the regulation of Ca 2+ -stimulated AC activity in hippocampal neurons. A , the basic design of the citrine-Epac2-camps-CFP (Ci/C-Epac2-camps) sensor used for hippocampal experiments and fluorescent images taken from three individual hippocampal neurons showing cytosolic expression of the cAMP sensor. Scale bar , 20 μm. B , in vitro calibrations of the Ci/C-Epac2-camps compared with the original Epac2-camps. Note the reduced pH sensitivity of the citrine-CFP version. C , comparison of Ca 2+ -stimulated AC activity in control, AKAP150-HA-expressing, and AKAP150 knockdown hippocampal neurons assessed using Ci/C-Epac2-camps. 1 μ m FSK was added in Ca 2+ -free conditions at 120 s with the readdition of 2 m m external Ca 2+ at 180 s to monitor Ca 2+ -dependent cAMP production. Maximum FRET ratio change was obtained by the subsequent addition of 10 μ m FSK, 10 μ m isoproterenol, and 100 μ m IBMX. D , overlay of control, AKAP150 overexpression, and shRNA AKAP150 data to compare Ca 2+ -stimulated AC activities. E , data analysis showing significant delay in Ca 2+ stimulation of cAMP production in neurons overexpressing AKAP150. Data represent mean ± S.E. ( error bars ) for each condition. n values are indicated on the graph . *, p < 0.01.

Article Snippet: For knockdown of endogenously expressed AKAP150 in primary cultured hippocampal neurons, shRNA AKAP150 lentiviral particles (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added directly to cultured cells 72 h prior to experiments.

Techniques: Activity Assay, Expressing, In Vitro, Comparison, Control, Knockdown, Over Expression, shRNA

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Identification of regenerating factor as a regulator of therapeutic genes for Parkinson's disease therapy. A) Conceptual diagram outlining the basis of an epigenetic regulator. B) Comparative gene expression heatmap of substantia nigra (SN) in wild type control versus 6‐OHDA‐induced Parkinson's disease (PD) mouse model. C) Heatmap showing gene expression profiles in the caudate and putamen regions of healthy individuals (HI) and a cohort of human PD patients. BG: Basal Ganglia. D) Immunofluorescence images showing TUJ1‐ and MAP2‐positive cells under each condition. Scale bar = 50 µm. E) Immunochemistry and Sholl analysis of TH‐labeled neurons. Left panel: morphology of individual neurons. Right panel: Sholl analysis showing the number of neurite intersections as a function of distance from the soma. Scale bar = 100 µm. The data are presented as mean ± SEM ( n = 5 – 6 cells per group). F) Representative traces of action potentials evoked by depolarizing current injections under each condition (sham, 6‐OHDA, 6‐OHDA+NDST3). G) Dot plot showing the top 14 GO Biological Process terms from enrichment analyses: 6‐OHDA versus Sham (left side) and 6‐OHDA+NDST3 versus 6‐OHDA (right side). H) Pearson correlation matrix of transcriptomic among samples.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Gene Expression, Control, Immunofluorescence, Labeling

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Therapeutic efficacy of NDST3 and retrograde tracing with CTB in mice. A) Schematic diagram of in vivo experimental design involving CTB injection in the PD mouse model. B) Representative immunofluorescence images of CTB, TH, and NDST3 expression in the SN of Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). C) Quantification of CTB‐, TH‐, and NDST3‐positive cells shown in Figure . Data are presented as mean ± SEM ( n = 6 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. ** p < 0.01, *** p < 0.001, **** p < 0.0001, and ns = not significant. D) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm and 10 µm (Magnified image). E) 3D Z‐stack analysis (IMARIS) of TH‐positive neurons obtained via confocal microscopy. F) DAB‐DAT staining in the SN.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Drug discovery, Retrograde Tracing, In Vivo, Injection, Immunofluorescence, Expressing, Confocal Microscopy, Staining

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Efficacy and electrophysiological properties of NDST3 in chemical‐induced PD model. A) Representative traces of spontaneous firing currents recorded from DA neurons of the SNpc in brain slices from each group. B) Cumulative fractions curves showing shortened inter‐event intervals, indicating a higher frequency of spontaneous firing in the 6‐OHDA + NDST3 group compared to the 6‐OHDA group. The inner bar graph showed mean inter‐event intervals in the ipsilateral of SNpc of each group. Data are presented as mean ± SEM ( n = 6 – 8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001. C) Quantification of DA neuronal firing rates in the ipsilateral SNpc of each group. The data are presented as mean ± SEM ( n = 6–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, and ** p < 0.01. D) Representative in vivo recording traces from the SNpc of live animals in each condition. E) Instantaneous firing frequencies during the recorded period. ( n = 4–6 independent animals per group; repeated measures) Two‐way ANOVA with Tukey's multiple comparisons test, * p < 0.05. F) Comparison of action potential waveforms among DA neurons across conditions. G) Representative image of DAB‐TH staining in ST and SN. Scale bar = 1 mm. H) Immunofluorescence images showing GIRK2‐ and TH‐positive cells in the Sham, MPTP‐induced PD mice, NDST3‐treated PD mice, and NDST3 only‐treated mice. Scale bar = 50 µm and 10 µm (Magnified image). I) Error count during the challenging beam traversal test for each experimental condition. The data are presented as mean ± SEM. ( n = 7 – 8 independent animals per group) Two‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. J) Errors per step during the challenging beam traversal test across conditions. The data are presented as mean ± SEM ( n = 7 – 8 independent animal per group). One‐way ANOVA with Tukey's multiple comparisons test. **** p < 0.0001. K) Fall latency in the wire‐hanging test. The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. *** p < 0.001 and **** p < 0.0001. L) Time to orient downward (T‐turn) and M) time to descend to the base (T‐total). The data are presented as mean ± SEM ( n = 7–8 independent animals per group). One‐way ANOVA with Tukey's multiple comparisons test. * p < 0.05, *** p < 0.001 and **** p < 0.0001.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: In Vivo, Comparison, Staining, Immunofluorescence

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Molecular mechanisms of NDST3 in the PD model. A) One‐way hierarchical clustering heatmap based on Z‐score of normalized expression value for 5629 genes selected with fold change ≥ 2 and raw p ‐value < 0.05. B) Principal component analysis (PCA) analysis of RNA‐seq data to visualize sample‐to‐sample variation. C) Volcano plot showing differentially expressed genes between 6‐OHDA and Sham group; Down‐regulated genes marked in blue. D) Volcano plot showing differentially expressed genes between 6‐OHDA+NDST3 and 6‐OHDA; Up‐regulated genes marked in red. E) Dot plot of top 14 GO cellular component terms from GO enrichment analyses: 6‐OHDA+NDST3 versus 6‐OHDA. Heatmap showing gene expression patterns in F) pre‐synaptic neurons, G) post‐synaptic neurons, and H) glia compartments. I) UMAP visualizing cluster identity. J) UMAP representation comparing cellular composition in 6‐OHDA and 6‐OHDA+NDST3. K) Branched trajectory analysis illustrating cell state transitions in a 2D state‐space, where each dot represents a single cell, color‐coded by group identity.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Expressing, RNA Sequencing, Gene Expression, Single Cell

Journal: Advanced Science

Article Title: NDST3‐Induced Epigenetic Reprogramming Reverses Neurodegeneration in Parkinson's Disease

doi: 10.1002/advs.202507323

Figure Lengend Snippet: Comprehensive analysis of spatial transcriptomics and epigenetic modulation following NDST3 treatment in a PD model. A) Heatmap showing gene expression patterns in each cluster. ** p < 0.01, and **** p < 0.0001. B) Gene concept network plot displaying genes enriched in catabolic, metabolic, and wound healing GO categories. The top 30 most differentially expressed genes comparing 6‐OHDA versus Sham and 6‐OHDA+NDST3 versus 6‐OHDA. Node color intensity represents the log2 fold‐change of gene expression. C) Cell‐cell communication network plot illustrating interactions among three distinct cell clusters in 6‐OHDA‐induced PD model (left panel) and NDST3‐treated PD model (right panel), based on ligand–receptor pair probabilities using the CellChat database. Line thickness indicates proportionality to the number of interactions. D) Spatial localization of dopamine‐related markers. E) Spatial mapping of dopaminergic lineage markers identified via scRNA‐Seq. F) Heatmap visualization of CUT&RUN and ATAC‐Seq signal intensity ±2 kb around the TSS. G) Immunofluorescence images showing H3K27ac and TH‐positive cells in the Sham, 6‐OHDA‐induced PD mice, and NDST3‐treated PD mice. Scale bar = 50 µm. H) Venn diagram illustrating overlapping genes among DEGs from RNA‐Seq, scRNA‐Seq Cluster 9, CUT&RUN peak, and ATAC‐Seq peak. Average signal plot of I) CUT&RUN and J) ATAC‐seq signals at over‐enriched TSS regions of the Ncoa7 gene. K) Structure of NDST3‐NCOA7‐H3K27ac complex. Blue – NDST3, Green – NCOA7, and Red – H3K27ac. The yellow boundary represents the interaction region.

Article Snippet: Slices were incubated with primary antibodies targeting dopaminergic neuron markers TH (Merck Millipore, AB152, Lot# 4127053; Merck Millipore, MAB318, Lot#3990619), GIRK2 (Abcam, ab259909, Lot# GR3401320‐4), NDST3 (Novus Biologicals, NBP2‐19501, Lot# 40723), DAT (Merck Millipore, MAB369) and histone modification marker H3K27ac (Abcam, AB4729, Lot# 1059037‐6).

Techniques: Spatial Transcriptomics, Gene Expression, Immunofluorescence, RNA Sequencing